View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18079_low_11 (Length: 325)
Name: NF18079_low_11
Description: NF18079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18079_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 315
Target Start/End: Complemental strand, 12197851 - 12197557
Alignment:
| Q |
17 |
aaattgtatttctactattttaactatcaaaatgtgacatttttagttttatctagaaaatactcaggtcacgaggcttgtcgggggagacaccgcacat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||| ||||||||||||| |
|
|
| T |
12197851 |
aaattgtatttctactattttaactatcaaaatgtgacatttttagttttatctagaaaatattcgggtcacga----tgtcggggaagacaccgcacat |
12197756 |
T |
 |
| Q |
117 |
ttacctaaaacaaggttattggttctatcacttataaagtgatcaacctcaatcttttaagtggaagctctttcatccgcacacagttgcacttgtaccg |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
12197755 |
ttacctaaaacaaggttattggtcctatcacttataaagtgatcaaccttaatctttcaagtggaagttctttcttccgcacacacttgcacttgtaccg |
12197656 |
T |
 |
| Q |
217 |
ccttccttcacaatgaaactcgccgcctaaacactctatcaggaagactttaaattcgacacgaggagttggtcgaaccttcgttgaacctcatctctg |
315 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12197655 |
ccttccttcacaatgaaacttgccgcctgaacactctatcaggaagactttcaattcaacacgaggagttggtcgaaccttcgttgaaactcatctctg |
12197557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University