View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1807R-Insertion-11 (Length: 608)
Name: NF1807R-Insertion-11
Description: NF1807R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1807R-Insertion-11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 9 - 246
Target Start/End: Complemental strand, 46184894 - 46184657
Alignment:
| Q |
9 |
gaagagaaaggtaccagctgggacccatattgggcttgaaacgatgatcaatggggagaagaagatgagggagacgacggtggcggcgacagttagaccg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184894 |
gaagagaaaggtaccagctgggacccatattgggcttgaaacgatgatcaatggggagaagaagatgagggagacgacggtggcggcgacagttagaccg |
46184795 |
T |
|
| Q |
109 |
gtaaggaggaggaaaatggatccagtgacgagtagggttaagagacctgcaagctgggttgagtttggggagtggagattgtcttgaagctttcttagaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184794 |
gtaaggaggaggaaaatggatccagtgacgagtagggttaagagacctgcaagctgggttgagtttggggagtggagattgtcttgaagctttcttagaa |
46184695 |
T |
|
| Q |
209 |
atgtgggtgaggtttggttatgatcagccattggaaag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184694 |
atgtgggtgaggtttggttatgatcagccattggaaag |
46184657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 182; E-Value: 4e-98
Query Start/End: Original strand, 320 - 584
Target Start/End: Complemental strand, 46184583 - 46184329
Alignment:
| Q |
320 |
gggacaggtgtggggttgttttggtgacatgcaagttgtgtacgtggaaggattagaggtgggaaatggggttttgttttgtttaggttccctcatatca |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184583 |
gggacaggtgtggggttgttttggtgacatgcaagttgtgtacgtggaaggaatagaggtgggaaatggggttttgttttgtttaggttccctcatatca |
46184484 |
T |
|
| Q |
420 |
ggtggatcaatgctatgctatcacactctgactttttcattcatgtattggcatcaataggaaccgtg-nnnnnnntaaggcaagagcatttatttttag |
518 |
Q |
| |
|
|||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46184483 |
ggtggatcaatgctat-------aacactgacttt----ttcatgtattggcatcaataggaaccgtgaaaaaaaataaggcaagagcatttatttttag |
46184395 |
T |
|
| Q |
519 |
ttttgcaatcagacatttctggcaggaccagttagtttgtcttatagcatgtcattcggttcattg |
584 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184394 |
ttttgcaatcagacatttctggcaggaccagttagtttgtcttatagcatgtcattcggttcattg |
46184329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University