View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1807_high_5 (Length: 238)
Name: NF1807_high_5
Description: NF1807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1807_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 52471369 - 52471584
Alignment:
| Q |
18 |
ggtttttattcatcagatgttagaatgaatttataacgatcgatcagcaaaataataatataacagtctgaaatgaactaatacttttgttttcaaagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471369 |
ggtttttattcatcagatgttagaatgaatttataacgatcgatcagcaaaataataatataacagtctgaaatgaactaatacttttgttttcaaagaa |
52471468 |
T |
|
| Q |
118 |
tttatttaaagaatatagctgacgggctttcttgtattacaagttatgtttttcattttcatttattttaaaatttcagatgaagtagaacctttgtccc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
52471469 |
tttatttaaagaatatagctgacgggctttcttgtattacaagttatgtttttcatattcatttattttaaaatttcagatgaagtagaaactttgtcac |
52471568 |
T |
|
| Q |
218 |
ctggctctcatccaat |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52471569 |
ctggctctcatccaat |
52471584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University