View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18080_high_1 (Length: 320)
Name: NF18080_high_1
Description: NF18080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18080_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 306
Target Start/End: Original strand, 5451147 - 5451430
Alignment:
| Q |
20 |
gcgtagaaatatttttgtgtgggaaaatgtaaacttagaggatctttttcggagtcttggaggaaagggggccaacggagggggacgatgtgtggtggtg |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||||| ||| |
|
|
| T |
5451147 |
gcgtagaaatattt--gtgtgggaaaatgtaaactaagaggatctttt-cggagtcttggaggaaaggaggccaacggagggggtagatgtgtggtagtg |
5451243 |
T |
 |
| Q |
120 |
gaatgcggaggatagaggtggttttttggtgaagtcgccttataacttggtgtatgatttgatggctacgactacacatttgatgaattctgaagaggtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
5451244 |
gaatgcggaggatagaggtggttttttggtgaagtcgccttataacttggtgtatgatttgatggctatgactacacatttgacgaaatctgaagaggtg |
5451343 |
T |
 |
| Q |
220 |
tcttccggtccatttggcaaagttcggctccatcaaaggttgtagctttctcttgaaaacgtcttcatgatcgtattccaaccaaga |
306 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5451344 |
tcttccggtccatttggcaaagtttggctccatcaaaggttgtagctttctcttgaaaacgtcttcatgatcgtattccgaccaaga |
5451430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 91 - 176
Target Start/End: Complemental strand, 20749189 - 20749104
Alignment:
| Q |
91 |
ccaacggagggggacgatgtgtggtggtggaatgcggaggatagaggtggttttttggtgaagtcgccttataacttggtgtatga |
176 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||| |||||||| ||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
20749189 |
ccaatggagggggagcatatgtggtggtggaatgtggaggataatggtggatttttggtgaaatcgtcttataacttggtgtatga |
20749104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 306
Target Start/End: Complemental strand, 20749042 - 20748974
Alignment:
| Q |
238 |
aaagttcggctccatcaaaggttgtagctttctcttgaaaacgtcttcatgatcgtattccaaccaaga |
306 |
Q |
| |
|
||||| ||||| | ||||||||||| |||||||||||||||| ||||| ||||||||| | ||||||| |
|
|
| T |
20749042 |
aaagtccggcttcgtcaaaggttgtggctttctcttgaaaacttcttctagatcgtatttctaccaaga |
20748974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 31 - 139
Target Start/End: Original strand, 31719102 - 31719209
Alignment:
| Q |
31 |
tttttgtgtgggaaaatgtaaacttagaggatctttttcggagtcttggaggaaagggggccaacggagggggacgatgtgtggtggtggaatgcggagg |
130 |
Q |
| |
|
||||||| |||||||||| || ||||| |||||||| ||| ||||||||||||||||||||| | ||||| || ||||| ||||||||||||||||||| |
|
|
| T |
31719102 |
tttttgtatgggaaaatgcaattttagaagatctttt-cggtgtcttggaggaaagggggccatcagagggagaggatgtatggtggtggaatgcggagg |
31719200 |
T |
 |
| Q |
131 |
atagaggtg |
139 |
Q |
| |
|
| ||||||| |
|
|
| T |
31719201 |
agagaggtg |
31719209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 227 - 286
Target Start/End: Original strand, 31719287 - 31719346
Alignment:
| Q |
227 |
gtccatttggcaaagttcggctccatcaaaggttgtagctttctcttgaaaacgtcttca |
286 |
Q |
| |
|
||| |||||||||||| ||| ||| |||||||| |||||||||||||| |||| |||||| |
|
|
| T |
31719287 |
gtcaatttggcaaagtccggttccgtcaaaggtagtagctttctcttggaaacttcttca |
31719346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University