View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18081_high_12 (Length: 265)
Name: NF18081_high_12
Description: NF18081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18081_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 50814758 - 50815010
Alignment:
| Q |
1 |
tctgtcagtttcacatattattggtacatcacgacacttctatctggttgtcccgttctagaggagttggaagcaaaggatgtaatagttacgagacgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50814758 |
tctgtcagtttcacatattattggtacatcacgacacttctatctggttgtcccgttctagaggagttggaagcaaaggatgtaatagttacgagacgtt |
50814857 |
T |
|
| Q |
101 |
gtatggtgattcgtacaggtagagaggttctaaacctatccaatttggtcagagctaacatttccaatggtttacttgagtttgattggctttataacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50814858 |
gtatggtgattcgtacaggtagagaggttctaaacctatccaatttggtcagagctaacatttccaatggtttacttgagtttgattggctttataacgt |
50814957 |
T |
|
| Q |
201 |
gaatcttctccgcatacaagaggtatgtatgtatatatgcatgtatatgatga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50814958 |
gaatcttctccgcatacaagaggtatgtatgtatatatgcatgtatatgatga |
50815010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 50861106 - 50860854
Alignment:
| Q |
1 |
tctgtcagtttcacatattattggtacatcacgacacttctatctggttgtcccgttctagaggagttggaagcaaaggatgtaatagttacgagacgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50861106 |
tctgtcagtttcacatattattggtacatcacgacacttctatctggttgtcccgttctagaggagttggaagcaaaggatgtaatagttacgagacgtt |
50861007 |
T |
|
| Q |
101 |
gtatggtgattcgtacaggtagagaggttctaaacctatccaatttggtcagagctaacatttccaatggtttacttgagtttgattggctttataacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50861006 |
gtatggtgattcgtacaggtagagaggttctaaacctatccaatttggtcagagctaacatttccaatggtttacttgagtttgattggctttataacgt |
50860907 |
T |
|
| Q |
201 |
gaatcttctccgcatacaagaggtatgtatgtatatatgcatgtatatgatga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50860906 |
gaatcttctccgcatacaagaggtatgtatgtatatatgcatgtatatgatga |
50860854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 36 - 222
Target Start/End: Original strand, 39559184 - 39559370
Alignment:
| Q |
36 |
acttctatctggttgtcccgttctagaggagttggaagcaaaggatgtaatagttacgagacgttgtatggtgattcgtacaggtagagaggttctaaac |
135 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||| || ||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
39559184 |
acttctatctgtttgtcccattctagaggagttggaagcaaaggatgtaatccttacggcactttgtaaggttattcgtacagctagagaggttctaaac |
39559283 |
T |
|
| Q |
136 |
ctatccaatttggtcagagctaacatttccaatggtttacttgagtttgattggctttataacgtgaatcttctccgcatacaagag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||| | ||||||||||| |||| |
|
|
| T |
39559284 |
ctatccaatttggtcagagctaacatttccaaaggttccatcgagtttgattggctttataacgtgagccatctccgcatacgagag |
39559370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 39558885 - 39558970
Alignment:
| Q |
1 |
tctgtcagtttcacatattattggtacatcacgacacttctatctggttgtcccgttctagaggagttggaagcaaaggatgtaat |
86 |
Q |
| |
|
|||||| ||||| || ||||| |||||||| || ||||||||| || |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
39558885 |
tctgtcggtttcccacattatgagtacatcatgaaacttctatccggctgtcccattctagaggagttggaagcaaaggatttaat |
39558970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 167
Target Start/End: Complemental strand, 49857374 - 49857344
Alignment:
| Q |
137 |
tatccaatttggtcagagctaacatttccaa |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49857374 |
tatccaatttggtcagagctaacatttccaa |
49857344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 36 - 77
Target Start/End: Original strand, 50814520 - 50814561
Alignment:
| Q |
36 |
acttctatctggttgtcccgttctagaggagttggaagcaaa |
77 |
Q |
| |
|
|||||||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
50814520 |
acttctatctagttgtcccattctagagaagttggaagcaaa |
50814561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 36 - 77
Target Start/End: Complemental strand, 50861344 - 50861303
Alignment:
| Q |
36 |
acttctatctggttgtcccgttctagaggagttggaagcaaa |
77 |
Q |
| |
|
|||||||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
50861344 |
acttctatctagttgtcccattctagagaagttggaagcaaa |
50861303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University