View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18082_low_10 (Length: 257)
Name: NF18082_low_10
Description: NF18082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18082_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 26735389 - 26735168
Alignment:
| Q |
17 |
cataggctaggatttccggcaaatgaccggtcgttgaagaccaaaaactgaccacctgtggggacaattccggtaaaattgttgtaagataaatccagcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735389 |
cataggctaggatttccggcaaatgaccggtcgttgaagaccaaaaactgaccacctgtggggacaattccggtaaaattgttgtaagataaatccagcg |
26735290 |
T |
|
| Q |
117 |
tcgttagactcgtcatgaatctaatctcatcagggattttcccagatatgttattatgcgaaacattaaaaatgcttagaaccttcagattcttcatccc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735289 |
tcgttagactcgtcatgaatctaatctcatcagggattttcccagatatgctattatgcgaaacattaaaaatgcttagaaccttcagattcttcatccc |
26735190 |
T |
|
| Q |
217 |
tttaggaacctcaccggtaagc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26735189 |
tttaggaacctcaccggtaagc |
26735168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 26727075 - 26726854
Alignment:
| Q |
17 |
cataggctaggatttccggcaaatgaccggtcgttgaagaccaaaaactgaccacctgtggggacaattccggtaaaattgttgtaagataaatccagcg |
116 |
Q |
| |
|
|||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26727075 |
cataagctagggtttcccgcaaatgaacggtcgttgaagaccaaaaactgaccaccggtggggacaattccggtgaaattgttgtaagataaatccagcg |
26726976 |
T |
|
| Q |
117 |
tcgttagactcgtcatgaatctaatctcatcagggattttcccagatatgttattatgcgaaacattaaaaatgcttagaaccttcagattcttcatccc |
216 |
Q |
| |
|
||||||||||| ||||||||||||| |||| ||||||| ||| |||||| |||||||||||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
26726975 |
tcgttagactcatcatgaatctaatatcattggggatttgccccgatatgctattatgcgaaacattcaaaatgtttagcaccttcagattcttcatccc |
26726876 |
T |
|
| Q |
217 |
tttaggaacctcaccggtaagc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26726875 |
tttaggaacctcaccggtaagc |
26726854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University