View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18082_low_11 (Length: 249)
Name: NF18082_low_11
Description: NF18082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18082_low_11 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 32616201 - 32616439
Alignment:
| Q |
11 |
atgaaggaaatcaagtactttgatgttataaattatattcaccttgcatcaattatttcaagcaacttgctttggtacttgttgccaagaacctgatgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616201 |
atgaaggaaatcaagtactttgatgttataaattatattcaccttgcatcaattatttcaagcaacttgctttggtacttgttgccaagaacctgatgaa |
32616300 |
T |
|
| Q |
111 |
ttataagttcaattagataaacaaaatttcatttcttgaaatacaagcaaaacttattaagatatgatctatgtatcttctcacatggatttttgcggtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616301 |
ttataagttcaattagataaacaaaatttcatttcttgaaatacaagcaaaacttattaagatatgatctatgtatcttctcacatggatttttgcggtg |
32616400 |
T |
|
| Q |
211 |
gtctttgggtcaaggaaagatttaacagtgttccacaac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616401 |
gtctttgggtcaaggaaagatttaacagtgttccacaac |
32616439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 8071245 - 8071187
Alignment:
| Q |
49 |
tcaccttgcatcaattatttcaagcaacttgctttggtacttgttgccaagaacctgat |
107 |
Q |
| |
|
||||||| | |||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
8071245 |
tcacctttcgtcaattatttcaagcaacttactatcatacttgttgccaagaacctgat |
8071187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 190 - 247
Target Start/End: Complemental strand, 8071110 - 8071053
Alignment:
| Q |
190 |
ctcacatggatttttgcggtggtctttgggtcaaggaaagatttaacagtgttccaca |
247 |
Q |
| |
|
||||||| ||||||||| |||||||| || |||||||| ||||| ||||||||||||| |
|
|
| T |
8071110 |
ctcacattgatttttgctgtggtcttgggatcaaggaaggattttacagtgttccaca |
8071053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 104
Target Start/End: Original strand, 26670717 - 26670759
Alignment:
| Q |
62 |
attatttcaagcaacttgctttggtacttgttgccaagaacct |
104 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
26670717 |
attacttcaagcaatttgctttggtacttgtttccaagaacct |
26670759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University