View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18082_low_13 (Length: 230)
Name: NF18082_low_13
Description: NF18082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18082_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 219
Target Start/End: Original strand, 7348620 - 7348824
Alignment:
| Q |
20 |
tttaaatgctcattctctttaccatgcatatatttattgtacttcatgttgttccctttttctctcatcacttga-----tcactctctcctttcctaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7348620 |
tttaaatgctcattctctttaccatgcatatatttattgtacttcatgttgttccctttttctctcatcacttgatttgatcactctctcctttcctaat |
7348719 |
T |
|
| Q |
115 |
catgttcttcttctcctctttccacgaattacttcatctccgctttcactatgcagatcaaccatgttcttttttccacactcttttgtctccatttcat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
7348720 |
catgttcttcttctcctctttccacgaattacttcatctccgctttcactatgcagatcaaccatgttcttttttccacactcttttgtctccattgcct |
7348819 |
T |
|
| Q |
215 |
ctcac |
219 |
Q |
| |
|
||||| |
|
|
| T |
7348820 |
ctcac |
7348824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University