View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18082_low_5 (Length: 347)
Name: NF18082_low_5
Description: NF18082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18082_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 298
Target Start/End: Original strand, 42427885 - 42428168
Alignment:
| Q |
15 |
atatattgcttgcaatgcaagttggagctgtgtccgcaccatactgtagcagttgtgagttcattgtcaaatttatttactactacgacggttaatctcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42427885 |
atatattgcttgcaatgcaagttggagctgtgtccgcaccatactgtagcagttgtgagttcattgtcaaatttatttact-ctacgacggttaatctcc |
42427983 |
T |
 |
| Q |
115 |
aagcatcttcacatcacggttgttactgtgaatttctttcaatttgaattttctttgtttgtagctgtttaaattgttcttggttgcacgatatacaagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42427984 |
aagcatcttcacatcacggttgttactgtgaatttctttcaatttgaattttctttgtttgtagctgtctaaattgttcttggttgcacgatatacaagt |
42428083 |
T |
 |
| Q |
215 |
aatacacnnnnnnnactctttgttaccttgaaaaacacatgacaaacaa-tttagatgtggtaaaatttgggacctggatcgtct |
298 |
Q |
| |
|
||| ||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
42428084 |
aattcactttttttactctttgttgccttgaaaaacacatgacaaacaactttagatgtggtaaaatttgggaccgagatcgtct |
42428168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University