View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18084_high_7 (Length: 249)
Name: NF18084_high_7
Description: NF18084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18084_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 27263090 - 27262933
Alignment:
| Q |
1 |
gctagcacaaggcaaggcttccaacgtgttttgccaaagagtatggtgtggcccttgacgactacgtaatgctgcgtgatccggagcgtaacgtcaccgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| || |||||||| |
|
|
| T |
27263090 |
gctagcacaaggcaaggcttccaacgtgttttgccaaagagtatggtgtggcccttgacgactatgtaatgctgcgtgatccgaagcgaaatgtcaccgt |
27262991 |
T |
 |
| Q |
101 |
tgttcaggttgaaaagaagaatgagaaagtttaccttgacaatttgtaggttgtgaca |
158 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27262990 |
tgttcaggttgaaaagaagaatgggaaagtttaccttgacaatttgtaggttgtgaca |
27262933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 172 - 241
Target Start/End: Complemental strand, 27262894 - 27262825
Alignment:
| Q |
172 |
atcatgaggtcaattttgagtatattcttttgtagtttttgtggcttggctattttctatgttttcatct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27262894 |
atcatgaggtcaattttgagtatattcttttgtagtttttgtggcttggctattttctatattttcatct |
27262825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University