View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18084_high_9 (Length: 221)
Name: NF18084_high_9
Description: NF18084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18084_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 28641533 - 28641684
Alignment:
| Q |
1 |
cccgaggaaatttcaacgatcgctgcgtgtcctcgcacggagtatactccgataaagcaacatcacaaaccggcgcgtgggtaacacgctctgcggtttc |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28641533 |
cccgaggaaatttcaacgatcgctgtgtgtcctcgcacggagtatactccgataaagcaacatcacaaaccggcgcgtgggtaacacgctctgaggtttc |
28641632 |
T |
 |
| Q |
101 |
tggtgggtcagggacgttatgatgggctgagaaatcaagagtggtggaagaa |
152 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28641633 |
tggtgggtcggggacgttatgatgggctgagaaatcaagagtggtggaagaa |
28641684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University