View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18086_low_5 (Length: 293)
Name: NF18086_low_5
Description: NF18086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18086_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 9658244 - 9658017
Alignment:
| Q |
19 |
cttagatgtatatgtgtnnnnnnncttttatgtcgacaatgtttgtacaatgtattatccatgattgtgcctcaaattcggttaacatatattctgtcag |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658244 |
cttagatgtatatgtgtaaaaaaacttttatgtcgacaatgtttgtacaatgtattatccatgattgtgcctcaaattcggttaacatatattctgtcag |
9658145 |
T |
|
| Q |
119 |
ctcagttgtttgtacaattcagacgaggtattttagaaagcatgcattgatacgcatatataaaggttgaaactactccattcattacaaacaaatttgg |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658144 |
ctcagttgtttgtacaatccagacgaggtattttagaaagcatgcattgatacgcatacataaaggttgaaactactccattcattacaaacaaatttgg |
9658045 |
T |
|
| Q |
219 |
atcatgcatgcagttactcataaaggag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9658044 |
atcatgcatgcagttactcataaaggag |
9658017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University