View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_high_29 (Length: 281)
Name: NF18089_high_29
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 261
Target Start/End: Original strand, 42250114 - 42250361
Alignment:
| Q |
15 |
atacatacacacgcaaaggtgaaggaaaatgcgaaggaatatgcagatagggacgatgaagctgaacaagaatgaagatggatttggatgataatgatga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42250114 |
atacatacacacgcaaaggtgaaggaaaatgcgaaggaatatgcagatagggacgatgaagctgaacaagaatgaagatggatttggatgataatgatga |
42250213 |
T |
 |
| Q |
115 |
tgatgttatatatgaagcttttctcgtctatgtgtttttgaccaattagaattatacacgtggtggatccatctttcttttatgaatatcctttttccaa |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42250214 |
tgatgttatatatgaagtttttctcgtctatgtgtttttgaccaattagaattatacacgtggtggatccatctttcttttatgaatatcctttttccaa |
42250313 |
T |
 |
| Q |
215 |
taccaataaattagttggg-aataccgtgaatctatgtcactcaatgt |
261 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42250314 |
taccaataaattagttgggaaataccgtgaatctatgtcactcaatgt |
42250361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University