View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_high_44 (Length: 223)
Name: NF18089_high_44
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 21 - 211
Target Start/End: Original strand, 3618351 - 3618543
Alignment:
| Q |
21 |
aatcataattttatatgtttaatttgatttagtgtttcgaacnnnnnnnn--aatagaatttgattttattttattgaaggttgatgagaacaatcgcga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3618351 |
aatcataattttatatgtttaatttgatttagtttttcgaacttttttttttaattgaatttgattttattttattgaaggttgatgagaacaatcgcga |
3618450 |
T |
 |
| Q |
119 |
tcacactgaagaagagcaagaattgaaataccttgaattcgtgcaattcgcaacgatccaagccgttatgcgatgcgcaattctctattccta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3618451 |
tcacactgaagaagagcaagaattgaaataccttgaattcgtgcaattcgcaacgatccaagccgttatgcgatgcgcaattctctattccta |
3618543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University