View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_low_28 (Length: 343)
Name: NF18089_low_28
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 11382321 - 11382522
Alignment:
| Q |
17 |
gaaccttctaaccatataatttggaaactctagtgtggagtttgtgtaaa-ataagcaaataagattgtccatgatcttgctaaagcggcgacaaatacc |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||| ||| |||| ||||||||||||| |||||||||||||||| ||| | | ||||| |
|
|
| T |
11382321 |
gaaccttctaatcatataatttggaaactctagcgtggagtttgtgcaaagataaacaaataagattgttcatgatcttgctaaagtggccatatatacc |
11382420 |
T |
 |
| Q |
116 |
gtgagtgttatgattaatgccgacgatacttagcaagataatgcttgattgttatcgttgtacggatttataatgattatattttaattaatgaaatgct |
215 |
Q |
| |
|
|| |||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||| | |||||||||||| |||||||||| ||||||||| |
|
|
| T |
11382421 |
gttagtgttataattaatgccgatgatacttagcaagataatgtttgattgttatcgttgtacgaaattataatgattaaattttaattattgaaatgct |
11382520 |
T |
 |
| Q |
216 |
at |
217 |
Q |
| |
|
|| |
|
|
| T |
11382521 |
at |
11382522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 237 - 332
Target Start/End: Original strand, 11382581 - 11382676
Alignment:
| Q |
237 |
atagtttgtataagctgaagtatacaaaccgagttaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttctt |
332 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11382581 |
atagtttgtataagctaaagtatgcaaaccgaattaaatgagaatccttttgaagcagaagtagtgattgtgctctgtcttcgttgtatacttctt |
11382676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University