View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_low_30 (Length: 321)
Name: NF18089_low_30
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 4 - 310
Target Start/End: Original strand, 8205171 - 8205477
Alignment:
| Q |
4 |
aatatcaaattgagaaatcatagcttgacactcatctatacttctacactcacccaatcttccaagcattctctttagactctttggtgtgatgcaacca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8205171 |
aatatcaaattgagaaatcatagcttgacattcatctacacttctacactcacccaatcttccaagcattctctttagactctttggtgtgatgcaacca |
8205270 |
T |
|
| Q |
104 |
catccctccatttcatacatcttaaaagcctctcttaggtcatttactttctcttcctctttccctccctctacaaacttcacaaaatcatccaacccaa |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8205271 |
catccttccatttcatacatcttaaaagcctctcttaggtcatttactttctcttcctctttccctccctctacaaacttcacaaaatcatccaacccaa |
8205370 |
T |
|
| Q |
204 |
tcaacccatcaccgtccgagtcgagaagctcaaccgccatttccgcctcctcgttcgacatctttgccccgattgcctcaacacattgccgcagctccga |
303 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8205371 |
tcaacccatccccgtccgagtcgagaagctcaaccgccatttccgcctcctcgtttgacatctttgccccgattgcctcaacacattgccgcagctccga |
8205470 |
T |
|
| Q |
304 |
tgatgat |
310 |
Q |
| |
|
||||||| |
|
|
| T |
8205471 |
tgatgat |
8205477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University