View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_low_35 (Length: 304)
Name: NF18089_low_35
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 37670537 - 37670707
Alignment:
| Q |
1 |
tagtaatttggagttggaacaaaatacaaatagagtttgatgagtcgaattcatatatacacttctaaacaatttgatatttattaaaactcatcaacca |
100 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37670537 |
tagtaatttggagatcgaagaaaatacaaatagagtttgatgagtcgaattcatatatacacttttaaacaatttgatatttattaaaactcatcaacca |
37670636 |
T |
 |
| Q |
101 |
cttgattatctataccgtccaatttatacaattgaaacttgatcaaaattacacatcataatgcttgataa |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37670637 |
cttgattatctataccgtccaatttatacaattgaaacttgatcaaaattacacatcataatgcttgataa |
37670707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 169 - 211
Target Start/End: Original strand, 37670722 - 37670764
Alignment:
| Q |
169 |
taaatgaagaatatgtagcacaaaataatgtatgtatgtgtta |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37670722 |
taaatgaaaaatatgtagcacaaaataatgtatgtatgtgtta |
37670764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University