View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18089_low_43 (Length: 281)

Name: NF18089_low_43
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18089_low_43
NF18089_low_43
[»] chr7 (1 HSPs)
chr7 (15-261)||(42250114-42250361)


Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 261
Target Start/End: Original strand, 42250114 - 42250361
Alignment:
15 atacatacacacgcaaaggtgaaggaaaatgcgaaggaatatgcagatagggacgatgaagctgaacaagaatgaagatggatttggatgataatgatga 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42250114 atacatacacacgcaaaggtgaaggaaaatgcgaaggaatatgcagatagggacgatgaagctgaacaagaatgaagatggatttggatgataatgatga 42250213  T
115 tgatgttatatatgaagcttttctcgtctatgtgtttttgaccaattagaattatacacgtggtggatccatctttcttttatgaatatcctttttccaa 214  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42250214 tgatgttatatatgaagtttttctcgtctatgtgtttttgaccaattagaattatacacgtggtggatccatctttcttttatgaatatcctttttccaa 42250313  T
215 taccaataaattagttggg-aataccgtgaatctatgtcactcaatgt 261  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||    
42250314 taccaataaattagttgggaaataccgtgaatctatgtcactcaatgt 42250361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University