View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_low_46 (Length: 275)
Name: NF18089_low_46
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 7 - 256
Target Start/End: Original strand, 3526963 - 3527215
Alignment:
| Q |
7 |
agtgagatgaagaggattttacctgggggctgcaatgacgacaggggaagagttggagaagaagctgaaaatttccaattacgaaatatcaggatataaa |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
3526963 |
agtgaaatgaagaggattttacctgggggctgcaatgacgacaggggaagagttggagaagaagctgaaaatttccaataaggaaatatcaggatataaa |
3527062 |
T |
|
| Q |
107 |
tgcatggattgatgtaatctcattattattataaattgaattgatgaaagtagtgtac----ttatatggtagaattggaaaataaaaaagtaata-tcc |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3527063 |
tgcatgtattgatgtaatctcattattattataaattgaattgatgaaagtagtgtacttaattatatggtagaattggaaaataaaaaagtaatattcc |
3527162 |
T |
|
| Q |
202 |
tctaaaaatcaaannnnnnnncttcttcaatgggtcagtcgatttaggacggaag |
256 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3527163 |
tctaaaaatcaa--ttttttttttcttcaatgggtcagtcgatttaggacggaag |
3527215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University