View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_low_52 (Length: 243)
Name: NF18089_low_52
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 31849250 - 31849131
Alignment:
| Q |
119 |
tgaattttgcaggacgacacattaccaaagctgaattttattaatgccttgtaaagatacatacatcttgaagacaagaaaccatctttatttgctta-- |
216 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31849250 |
tgaattattcaggacgacacattaccaaagctgaattttattaatgccttgtaaagatacatacatcttgaagacaagaaaccatctttatttgcttagt |
31849151 |
T |
 |
| Q |
217 |
gtgattctattcctatgctt |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31849150 |
gtgattctattcctatgctt |
31849131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 31849319 - 31849250
Alignment:
| Q |
19 |
tgacattattttgtagcttcatgtttttcaataaaaatacatataaactttttctttgggtgaatatcat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31849319 |
tgacattattttgtagcttcatgtttttcaataaaaatacatataaactttttcattgggtgaatatcat |
31849250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 148
Target Start/End: Complemental strand, 11469319 - 11469191
Alignment:
| Q |
20 |
gacattattttgtagcttcatgtttttcaataaaaatacatataaactttttctttgggtgaatatcattttatgataacatgaattattcaatcaagct |
119 |
Q |
| |
|
||||| ||| |||| ||| || ||||||| |||||||||| | | ||||||||||||||| ||||||||||| |||||||| || ||||| ||||||||| |
|
|
| T |
11469319 |
gacataattctgtaacttgatttttttcagtaaaaatacaaacacactttttctttgggtcaatatcattttttgataacacgagttattaaatcaagct |
11469220 |
T |
 |
| Q |
120 |
gaattttgcaggacgacacattaccaaag |
148 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |
|
|
| T |
11469219 |
gaattttgcaggaggacgcattaccaaag |
11469191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University