View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_low_56 (Length: 230)
Name: NF18089_low_56
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 2622933 - 2623128
Alignment:
| Q |
20 |
atgatagcacttgcacataaacttgtacgggttgacatgacgctatttggttgcttgcttgttcaatgaatcaaaaatggattttatgcagacataatct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2622933 |
atgatagcacttgcacataaacttgtacgggttgacatgacgctatttggttgcttgcttgttcaatgaatcaaaaatggattttatgcagacataatct |
2623032 |
T |
 |
| Q |
120 |
gaatacacttgaaccatattaaacttgttcaggtgttggtattataatgttccagcttggcttatatcaatcagtgcaaaaaatttgtggacctat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2623033 |
gaatacacttgaaccatattaaacttgttcaggtgttggtattataatgttccagcttggcttatatcaatcagtgcaaaaaatttgtggacctat |
2623128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University