View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18089_low_63 (Length: 204)
Name: NF18089_low_63
Description: NF18089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18089_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 26611213 - 26611042
Alignment:
| Q |
16 |
caattctcatctttattgcattttactttgtccgaggggatatctatgatttacaccatgcaacattgggtattttcttatcctcaannnnnnnnattgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26611213 |
caattctcatctttattgcattttactttgtccgaggggatatctatgatttacaccatgcaacattgggtattttcttatcctcaa-tttttttattgt |
26611115 |
T |
 |
| Q |
116 |
ttttattaaacttattaggcaaagttgctcttgtagtcttttatattaatttcagttaacatttaacgttctt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26611114 |
ttttattaaacttattaggcaaagttgctcttgtagtcttttatattaatttcagttagcatttaacgttctt |
26611042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University