View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1808_high_8 (Length: 273)
Name: NF1808_high_8
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1808_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 14734950 - 14734782
Alignment:
| Q |
1 |
ccaatctgtgagactcgtgggtagattatactctcattaatacatggttatttaatttccaagttattcttgggagttcacatgtcgcgatcagacgagc |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | || |
|
|
| T |
14734950 |
ccaatccgtgagactcgtgggta--ttacactctcattaatacatggttatttaatttccaagttattcttgggagttcacgtgtcgcgatcagaggggc |
14734853 |
T |
|
| Q |
101 |
tagcttgcacttttcactgcctcataaggttaactcatcaaaccaaagtgcgctatactagtaccaattcc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14734852 |
tagcttgcacttttcactgcctcataaggttaactcatcaaaccaaagtgcgctatactagtaccgattcc |
14734782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 30 - 216
Target Start/End: Complemental strand, 15596193 - 15596007
Alignment:
| Q |
30 |
actctcattaatacatggttatttaatttccaagttattcttgggagttcacatgtcgcgatcagacgagctagcttgcacttttcactgcctcataagg |
129 |
Q |
| |
|
||||||||| ||||| ||||| ||||||||| |||| || ||||||||||||| ||||| |||| | |||||||||||||| ||||||| |||||||| |
|
|
| T |
15596193 |
actctcattgctacattgttatcaaatttccaaattatcct-gggagttcacatgccgcgaccagaggggctagcttgcacttctcactgcttcataagg |
15596095 |
T |
|
| Q |
130 |
ttaactcatcaaaccaaagtgcgctatactagtacc-aattccccttgaacagatactacatacttgatggttcagtttacttgcatt |
216 |
Q |
| |
|
||| ||||||| ||| | || | || | || || ||||||||||| |||||||||||||||||||||| || ||||||||||| |
|
|
| T |
15596094 |
ttagctcatcagacctacgtatcatgtagtcgttccgctttccccttgaatagatactacatacttgatggttgagcttacttgcatt |
15596007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University