View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1808_low_11 (Length: 257)
Name: NF1808_low_11
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1808_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 34863463 - 34863222
Alignment:
| Q |
1 |
cttttatcttataaataattacactatttttaagtaaacttacnnnnnnnn--agtattttaactaataccccaaatgcagtcattaacattcttcttga |
98 |
Q |
| |
|
|||||||||||| ||||||||| | ||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34863463 |
cttttatcttatcaataattacgccatttttacgtaaacttacttttttttttagtattttaactaataccccaaatgcagtcattaacattcttcttga |
34863364 |
T |
 |
| Q |
99 |
attaataacccaactcgatacattattagagtgaataaattatctgagttttataatattacattcaaccggttcaactatataaaaattgtacattatc |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34863363 |
attaataacccaactcgatacattattcgagtgaataaattatctgagttttataatattacattcaaccggttcaactatataaaaattgtacattatc |
34863264 |
T |
 |
| Q |
199 |
taagcactagaaacaaggttgcaggtaggtatatatggatgg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34863263 |
taagcactagaaacaaggttgcaggtaggtatatatggatgg |
34863222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University