View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1808_low_12 (Length: 254)
Name: NF1808_low_12
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1808_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 152 - 216
Target Start/End: Original strand, 7796335 - 7796400
Alignment:
| Q |
152 |
taaacacaagagcaatgctttttg-gcaacaaattttagacaacttctgcaacaacattttcaatg |
216 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7796335 |
taaacaaaagagaaatgctttttccgcaacaaattttagacaacttctgcaacaacattttaaatg |
7796400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 27 - 109
Target Start/End: Original strand, 54292994 - 54293075
Alignment:
| Q |
27 |
gtttgtctaagaagcagactttgaagataaaaggtggagaggaagaatagatgaattagaggatgagggaaataagagctgca |
109 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||| ||||||||||| | || ||| |||||||||| ||||||||||||| |
|
|
| T |
54292994 |
gtttgtctaagaagaaggctttgaagatcaaaggtgaagaggaagaatcaacgagttaaaggatgaggg-aataagagctgca |
54293075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University