View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1808_low_15 (Length: 249)
Name: NF1808_low_15
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1808_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 86 - 216
Target Start/End: Complemental strand, 34863865 - 34863721
Alignment:
| Q |
86 |
tgtttattgaaaaagttaaatagtttaactctcacgcattgaatgctataaaattttacta---tattaaggttgtcaaggagtcgtttgc--------- |
173 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| || ||||||| |||| || ||||||||| | |
|
|
| T |
34863865 |
tgtttattgaaaaggttaaatagtttaactctcatgcattgaatgctataaaattttattatagtattaagattgttaatgagtcgttttcatttctcag |
34863766 |
T |
 |
| Q |
174 |
--ataatattttaacaaaggagacacaacatctcctttcatgatt |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34863765 |
atataatattctaacaaaggagacacaacatctcctttcatgatt |
34863721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 34863978 - 34863936
Alignment:
| Q |
10 |
attattctaaactttttgccaaactgagaatcaaatctattat |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34863978 |
attattctaaactttttgccaaactgagaatcaaatccattat |
34863936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University