View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1808_low_16 (Length: 242)
Name: NF1808_low_16
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1808_low_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 51433231 - 51433472
Alignment:
| Q |
1 |
tggagaatatttatgattcatatctgctagcaacagctgtcttggtctcagatctgatttagtatgtaaattaaactagaccacttctttgaactaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51433231 |
tggagaatatttatgattcatatctgctagcaacagctgtcttggtctcagatctgatttagtatgtaaattaaactagaccacttctttgaactaataa |
51433330 |
T |
 |
| Q |
101 |
tttccatctcaagttcataataaacataatcccaaacaccaaactaaaacattctcatagcctagaagaaaacatttaaatccaagaaacttgttgtgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51433331 |
tttccatctcaagttcataataaacaaaattccaaacaccaaactaaaacattctcatagcctagaagaaaacatttaaatccaagaaacttgttgtgct |
51433430 |
T |
 |
| Q |
201 |
tacatgttcattcctttcaattttttctatgattcctatgct |
242 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51433431 |
tacaagttcattcctttcaattttttctatgattcctatgct |
51433472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University