View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1808_low_19 (Length: 227)

Name: NF1808_low_19
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1808_low_19
NF1808_low_19
[»] chr3 (2 HSPs)
chr3 (24-141)||(33388412-33388530)
chr3 (165-227)||(33388327-33388389)
[»] chr7 (1 HSPs)
chr7 (23-90)||(49035298-49035366)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 24 - 141
Target Start/End: Complemental strand, 33388530 - 33388412
Alignment:
24 tgttttcattgtttagttgctctacttt-taaatattggtttgacaccgttgtttttctttggtacaccttttattagggaggatattttgtggtaatat 122  Q
    ||||||||||| |||||||||||||||| ||||||| | ||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||    
33388530 tgttttcattgcttagttgctctactttgtaaatatagatttgacaccgttgtttttctttgatacaccttttattagggaggacattttatggtaatat 33388431  T
123 atttatttttagcttttta 141  Q
    ||||  |||||||||||||    
33388430 atttcattttagcttttta 33388412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 165 - 227
Target Start/End: Complemental strand, 33388389 - 33388327
Alignment:
165 gatcaaataatgcaaagactaatacaatatttaaacatttagttgtggtagttgcctccaata 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
33388389 gatcaaataatgcaaagactaatacaatatttaaacatttagttgtggtagttgtctccaata 33388327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 90
Target Start/End: Complemental strand, 49035366 - 49035298
Alignment:
23 ttgttttcattgtttagttgctctacttt-taaatattggtttgacaccgttgtttttctttggtacac 90  Q
    |||| |||||||||| |||| | |||||| ||||||||||||||||||  ||||||||| |||||||||    
49035366 ttgtcttcattgttttgttgttttactttgtaaatattggtttgacactattgtttttccttggtacac 49035298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University