View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1808_low_8 (Length: 313)
Name: NF1808_low_8
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1808_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 33110240 - 33110478
Alignment:
| Q |
1 |
acacagacgttccatgtttgtagcaccactaaccgaagtagctatgagcatggagtcacattatgaggaggttgcacagaattaaatttaagacgccaca |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33110240 |
acacatacgttccatgtttgtagcaccactaaccgaagtagctatgagcatggagtcacattatgaggaggttgcatggaattaaatttaagacgccaca |
33110339 |
T |
|
| Q |
101 |
tatcctcaacagcctgataattcacatgctatccaaatttgattatttaattaaataaaaaagaataattttcacattttatttataaaagagatacatg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33110340 |
tatcctcaacggcctgataattcacatgctatccaaatttgattatttaattaaataaaaaagaataattttcacattttatttataaaagagatacatg |
33110439 |
T |
|
| Q |
201 |
attttggactgannnnnnnatctttcaattgtactcttc |
239 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
33110440 |
gttttggactgatttttttatctttcaattgtactcttc |
33110478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 9 - 47
Target Start/End: Original strand, 33110201 - 33110239
Alignment:
| Q |
9 |
gttccatgtttgtagcaccactaaccgaagtagctatga |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33110201 |
gttccatgtttgtagcaccactaaccgaagtagctatga |
33110239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University