View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1808_low_9 (Length: 299)
Name: NF1808_low_9
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1808_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 33388285 - 33388004
Alignment:
| Q |
1 |
tttatgttattaaaagataatttgatgtctcaaactattgtttcttttcatttaattgagtcaaaccaaataccgtatgannnnnnnnccattcctagaa |
100 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
33388285 |
tttatgctattaaaagataattggatgtctcaaactattgtttcttttcgtttaattgagtcaaacgaaataccgtatgattttttttccattcctagaa |
33388186 |
T |
 |
| Q |
101 |
gggacgacaaaacatgtaaataaaagnnnnnnnctttcttttaggcagatgtaactcacttcatttcatcaatgataataaaatcaatacaatttagatg |
200 |
Q |
| |
|
|| ||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33388185 |
ggaacggcaaaacatgtaaataaaagtttctt--tttcttttaggc-gatgtaactcacttcatttcatcaatgataataaaatcagtacaatttagatg |
33388089 |
T |
 |
| Q |
201 |
atgat-nnnnnnnngtatttgaatttgaccgtgatacatactttctagtaagcacaatcaacatcgcatttaagctagttgttga |
284 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33388088 |
atgataaaaaaaaagtatttgaatttgaccgtgatacatactttatagtaagcgcaatcaacatcgcatttaagctagttgttga |
33388004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University