View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809-Insertion-21 (Length: 279)
Name: NF1809-Insertion-21
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809-Insertion-21 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 152 - 279
Target Start/End: Complemental strand, 31788907 - 31788780
Alignment:
| Q |
152 |
cttgttcttcccaatcatagatcatagccccaaatattttccttgtcctaataccttgttcatcgagcataccttgatcatctttaattacagtacgtac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31788907 |
cttgttcttcccaatcatagatcatagccccaaatattttccttgtcctaataccttgttcatcgagcataccttgatcatctttaattacagtacgtac |
31788808 |
T |
|
| Q |
252 |
ctttctcatcaatgaacatttgataata |
279 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31788807 |
ctttctcatcaatgaacatttgataata |
31788780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 8 - 162
Target Start/End: Complemental strand, 31789200 - 31789047
Alignment:
| Q |
8 |
gaaatttcatcttcagtgcacaaatatttcttatggcaccgaa-gcacacttgataagaacctttctacctgcaccagacaacgtcttaccaagaattta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789200 |
gaaatttcatcttcagtgcacaaatatttcttatgctactgaaagcacacttgataagaacctttctacctgcaccagacaacgtcttaccaagaattta |
31789101 |
T |
|
| Q |
107 |
ttttcttccaaactccatctttgataaaattgaacactgattttccttgttcttcc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
31789100 |
ttttcttccaaactccatctttgataaaattgaacactaattt--cttgttcttcc |
31789047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 140
Target Start/End: Original strand, 23266027 - 23266071
Alignment:
| Q |
96 |
ccaagaatttattttcttccaaactccatctttgataaaattgaa |
140 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
23266027 |
ccaagaatttattttcttccaaacacggtctttgataaagttgaa |
23266071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University