View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809-Insertion-23 (Length: 212)
Name: NF1809-Insertion-23
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809-Insertion-23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 9 - 212
Target Start/End: Original strand, 41358601 - 41358804
Alignment:
| Q |
9 |
ggggaagcgccgagagcaacaggctaatgatagaggatcatcgatacaccacatctttaaccaaaactttcgatattgagtatataaattacctctctat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
41358601 |
ggggaagcgccgagagcaacaggctaatgatagaggatcatcgatacaccacatctttaaccaaaaccttcgatattgagtatatagattacctctctat |
41358700 |
T |
|
| Q |
109 |
ctaatatccgagttcattcataaatagtttcctaaagcttgtatatttcttatgaattaaatgtgagttccatgacttgagaaattttttgagttccgta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
41358701 |
ctaatatccgagttcattcataaatagtttcctaaagcatgtatatttcttatgaattaaatgcgatttccatgacttgagaaattttttgagttccgta |
41358800 |
T |
|
| Q |
209 |
tcaa |
212 |
Q |
| |
|
|||| |
|
|
| T |
41358801 |
tcaa |
41358804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University