View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809-Insertion-24 (Length: 276)
Name: NF1809-Insertion-24
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809-Insertion-24 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 142 - 276
Target Start/End: Complemental strand, 49081983 - 49081849
Alignment:
| Q |
142 |
gtggacgaagaagcaaacaaaagagaatagttttttcaaactactttaaatgcttaatagccgccttacagccacgaaaactaaatatcttattgctttc |
241 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49081983 |
gtggaggaagaagaaaacaaaagagaatagttttttcaaactactttaaatgcttaatagccgccttacagccacgaaaactaaatatcttattgctttc |
49081884 |
T |
|
| Q |
242 |
tttgtttttgtggtttcagattcaaccagatctat |
276 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
49081883 |
tttgtttttgtggtctcagattcaaccagatctat |
49081849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 7 - 113
Target Start/End: Complemental strand, 49082099 - 49081997
Alignment:
| Q |
7 |
aaaacaaaaaccgcatcaacaaacaagagaacgaaatcgtatgtatgtatctgttagttggctggagtcttaagtaagtaagttgaatgaatataacaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49082099 |
aaaacaaaaaccgcatcaacaaacaagagaacgaaatcgtatgtat----ctgttagttagctggagtcttaagtaagtaagttgaatgaatataacaaa |
49082004 |
T |
|
| Q |
107 |
atatctg |
113 |
Q |
| |
|
||||||| |
|
|
| T |
49082003 |
atatctg |
49081997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University