View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809-Insertion-29 (Length: 150)
Name: NF1809-Insertion-29
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809-Insertion-29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 15147124 - 15147013
Alignment:
| Q |
8 |
atgtgcatgtgcttagaaccatttcagttttttgaacaaccttaggtatataattttatttacacatcacaatttggttagttttattattgctttcata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15147124 |
atgtgcatgtgcttagaaccatttcagttttttgaacaaccttaggtatataattttatttacacatcacaatttggttagttttattattgctttcata |
15147025 |
T |
|
| Q |
108 |
ttacgatttata |
119 |
Q |
| |
|
| ||||||||| |
|
|
| T |
15147024 |
ctccgatttata |
15147013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University