View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809-Insertion-32 (Length: 94)
Name: NF1809-Insertion-32
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809-Insertion-32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 16874413 - 16874499
Alignment:
| Q |
8 |
cctaggtattctgtatatgtgcggcaccttgattgtatgtttccctttttaccgcgagttaaatgttccttacatttcctcgttgag |
94 |
Q |
| |
|
||||||| || ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16874413 |
cctaggtgttttgtatatatgcgacaccttgattgtatgtttccctttttaccgcgagttaaatgttccttacatttcctcgttgag |
16874499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University