View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18091_high_2 (Length: 236)
Name: NF18091_high_2
Description: NF18091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18091_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 8073133 - 8073354
Alignment:
| Q |
1 |
aacatggtattttatggcatgaagttattgcaccgtgaaatgtcatatgaaattgaaacatctggtttgtgaggtttgatttgctgagggcttgaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8073133 |
aacatggtattttatggcatgaagttattgcaccgtgaaatgtcatatgaaattgaaacatctggtttgtgaggtttgatttgctgagggcttgaacaaa |
8073232 |
T |
|
| Q |
101 |
gtttaatttgacttttgatagaatatatactgttttaaaactaggtacatttattaatttgtgggaaaattgcaccgtgacttatagtttgagatatata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8073233 |
gtttaatttgacttttgatagaatatatactgttttaaaactaggtacatttattaatttgtgtgaaaattgcacggtgacttatagtttgagatatata |
8073332 |
T |
|
| Q |
201 |
tgaattcatgagtgagagatat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8073333 |
tgaattcatgagtgagagatat |
8073354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University