View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18095_low_17 (Length: 240)
Name: NF18095_low_17
Description: NF18095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18095_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 65 - 119
Target Start/End: Original strand, 40397385 - 40397439
Alignment:
| Q |
65 |
ctcaagaatgctatgaaatttagcatatcctttcaatatatttttataggtcttt |
119 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40397385 |
ctcaagaatgctgtgaaatttagcgtatcctttcaatatatttttataggtcttt |
40397439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 113
Target Start/End: Complemental strand, 30282639 - 30282595
Alignment:
| Q |
69 |
agaatgctatgaaatttagcatatcctttcaatatatttttatag |
113 |
Q |
| |
|
|||||||||||||| || ||||| |||||| |||||||||||||| |
|
|
| T |
30282639 |
agaatgctatgaaactttgcatagcctttctatatatttttatag |
30282595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University