View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18095_low_21 (Length: 226)
Name: NF18095_low_21
Description: NF18095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18095_low_21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 42114186 - 42113961
Alignment:
| Q |
1 |
tttggtgctatagtggcagttatatggataattccaagtgccataaataaaattttatggtctaatttacagcagcaaggaaactggacagctttggcgt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42114186 |
tttggtgctatagtagcagttatatggataattccaagtgccataaataaaattttatggtctaatttacagcagcaaggaaactggacagctttggcgt |
42114087 |
T |
 |
| Q |
101 |
aagtattagcaaacactatccaatttctcttttgtaaaattaagttgtcaataactagacttaaaaactttctcattgtagattgatgtggaagactaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42114086 |
aagtattagcaaacactatccaatttctcttttgtaaaattaagttgtcgataactagacttaaaaactttctcattgtagattgatgtggaagactaca |
42113987 |
T |
 |
| Q |
201 |
ccgatcacagttttctttctcggagc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42113986 |
ccgatcacagttttctttctcggagc |
42113961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University