View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18095_low_3 (Length: 532)
Name: NF18095_low_3
Description: NF18095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18095_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 71 - 382
Target Start/End: Complemental strand, 10905735 - 10905426
Alignment:
| Q |
71 |
agatgaagaagaaggaaaaaacaaaccttgcaaatggggcaagtgattttgagaccagcacctctagcttcaatctgagaaccctttgatttctgattct |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10905735 |
agatgaagaagaaggaaaaaacaaaccttgcaaatggggcaagtgattttgagaccagcacctctagcttcaatctgagaaccctttgatttctgattct |
10905636 |
T |
|
| Q |
171 |
tctctgcgtttcgtttctgcgcttcgatcttctgctttccccgcgtca---tcttgttgttgtttgtgatcaatcaaacttcaaactcgaccaaagaaga |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10905635 |
tctctgcgtttcgtttctgcgcttcgatcttctgctttccccgcgtcatcttcttcttgttgtttgtgatcaatcaaacttcaaactcgaccaaagaaga |
10905536 |
T |
|
| Q |
268 |
aatgtgaaaaagaatgaccaaatgaattgaatttgataagaacaaacatgagacttaagtgggcccactttctcaataaaatattgtttgctttggtccc |
367 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10905535 |
aatgtgaaaaagaatgaccaaa-----tgaatttgataagaacaaacatgagacttaagtgggcccactttctcaataaaatattgtttgctttggtccc |
10905441 |
T |
|
| Q |
368 |
accattaggactacc |
382 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
10905440 |
accattaggattacc |
10905426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 453 - 520
Target Start/End: Complemental strand, 10905387 - 10905320
Alignment:
| Q |
453 |
cccaccattagcctttcaaaaatgtgaaattgacatttttagagaatgattgttaataggctaatatt |
520 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10905387 |
cccaccattagcctttcaaaaatgtgaaattgacatttttagagagtgattgttaataggctaatatt |
10905320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University