View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18096_low_2 (Length: 419)
Name: NF18096_low_2
Description: NF18096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18096_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 267
Target Start/End: Complemental strand, 42601931 - 42601682
Alignment:
| Q |
17 |
ttatgttgttatttttggtacttattttt-agcatatcaaactcattttttaatgtgtttgatttggcttttgcattgacagacttaagactatggtgcc |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||| ||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
42601931 |
ttatgttgttattttcggtacttattttttagcttatcaaattcattttttaatgtgtttgatttggctattgcatcgacagacttaagactatggtgcc |
42601832 |
T |
 |
| Q |
116 |
attttgacttgatttcatgaatctgtaaccagtcttagcttctagtaggcgtctactatcacctctaccatggaaaacaaacaaagcatattaattcatg |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42601831 |
atttggacttgatttcatgaatctgtaactagtctttgcttctagtaggcgtctactatcacctctaccatggaaaacaaacaaagc--attaattcatg |
42601734 |
T |
 |
| Q |
216 |
tgtttgtagaccgtttttagatagatctttgaaattgtgaacattgtaaaat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42601733 |
tgtttgtagaccgtttttagatagatctttgaaattgtgaacattttaaaat |
42601682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 411
Target Start/End: Complemental strand, 42601618 - 42601533
Alignment:
| Q |
329 |
atgcttcaaaagaaaaatcaacacnnnnnnncca-ttttctt--tatatcattgtcaacaacaaattacattattctcttcatctc |
411 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42601618 |
atgcttcaaaagaaaaatcaacactttttttccatttttctttatatatcattgtcaacaacaaattacattattctctccatctc |
42601533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University