View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18096_low_4 (Length: 306)
Name: NF18096_low_4
Description: NF18096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18096_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 269
Target Start/End: Original strand, 34292504 - 34292770
Alignment:
| Q |
10 |
ttattctatatgctgcaatgagattaataaaatatcttaaattaaacta-------gcataaaactcacattaaattaagacttttcaccacgatgattt |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34292504 |
ttattttatatgctgcaatgagattaataaaatatcttaaattaaactaacctttagcataaaactcacattaaattaagacttttcaccacgatgattt |
34292603 |
T |
 |
| Q |
103 |
gaacttgttctcacctaagtttataacaccacatctttgaggtatttgccctttgagtataatgttaagtcctcacaattttgttgtttgtaaatggcgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34292604 |
gaacttgttctcacctaagtttataacaccacatctttgaggtatttgccctttgagtataatgttaagtcctcacaattttgtcgtttgtaaatggcgt |
34292703 |
T |
 |
| Q |
203 |
ttagatgaatagaggagtgtgagtgtttataaactattcttaatcttaactgccaaacaatgtcata |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
34292704 |
atagatgaatagtggagtgtgagtgtttataaactatttttaatcttgactgtcaaacaatgtcata |
34292770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University