View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18097_high_12 (Length: 300)
Name: NF18097_high_12
Description: NF18097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18097_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 14 - 286
Target Start/End: Complemental strand, 33616489 - 33616196
Alignment:
| Q |
14 |
agaagaaaaagacacactatattgtgttttgctatagatttcatttacctttttgctagagaaaagtgatattggaattgaagaagagaaaatgaagtgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33616489 |
agaagaaaaagacacactatattgtgttttgctatagatttcatttacctttttgctagagaaaagtgatattggaattgaagaagagaaaatgaagtgg |
33616390 |
T |
 |
| Q |
114 |
ttgcatgggggtgcacgtgctgtgacggtaacaatgccgacagacactgca---------------------ttcttttttcgtacaaatgcaattctat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33616389 |
ttgcatgggggtgcacgtgctgtgacggtaacaatgccgacagacactgcattctctcacctgagctttcacttcttttttcgtacaaatgcaattctat |
33616290 |
T |
 |
| Q |
193 |
gtttgatagtaacatattaacctacggggttccaccgccgacgatgtgtctcttcctcgtcccttcaaaccccattgtccatataattgaaaat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33616289 |
gtttgatagtaacatattaacctacggggttccaccgccgacgatgtgtctcttcctcgtcacttcaaaccccattgtccatataattgaaaat |
33616196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University