View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18097_high_16 (Length: 222)
Name: NF18097_high_16
Description: NF18097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18097_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 15 - 129
Target Start/End: Complemental strand, 33590694 - 33590575
Alignment:
| Q |
15 |
atgaatgaggataaatccgctacggacgaatctattata-----atccaaaataatacactaattcaattttttagattaattaattaatggatggatag |
109 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33590694 |
atgaatgagaataaatcctctacggacgaatctattatattataatccaaaataatacactaattcaattttttagattaattaattaatggatggatag |
33590595 |
T |
|
| Q |
110 |
atatatctccgtaacatttt |
129 |
Q |
| |
|
|||||| ||| ||||||||| |
|
|
| T |
33590594 |
atatatgtccttaacatttt |
33590575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 136 - 205
Target Start/End: Complemental strand, 33589684 - 33589615
Alignment:
| Q |
136 |
ggggactcggcttctttaaagttctgtattattcaaagttacagggtcaggaaatctagtgattccttag |
205 |
Q |
| |
|
||||| || |||||||||||||| || |||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33589684 |
ggggattcagcttctttaaagttatggattattaaaagttacagggtcaggaaatctaatgattccttag |
33589615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University