View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18097_low_15 (Length: 295)
Name: NF18097_low_15
Description: NF18097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18097_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 33 - 247
Target Start/End: Complemental strand, 31755627 - 31755413
Alignment:
| Q |
33 |
aaacacctctacacacaagtttagatgtccctttcattcttcttttttgagatgtcactttcattctttttcaactcaatatatcataaaagaataatac |
132 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31755627 |
aaacacccctacacacaagtttagatgtccctttcattcttcttttttgagatgtcactttcattctttttcaaatcaatatatcataaaagaataatac |
31755528 |
T |
|
| Q |
133 |
ataacctt--tgaagttttttcttatctaaattaaaattatgcgtgttaatgcctgaattttgtttttgagaagcatgtgttaatgcctgatagatggtc |
230 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
31755527 |
ataacctttgtgaagttttttcttatctaaattaaaattatgcgtgttaatgcctgaattttgtttttgacaagca--tgttaatgcctgatagatggtc |
31755430 |
T |
|
| Q |
231 |
tagaagtagtttaattc |
247 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31755429 |
tagaagtagtttaattc |
31755413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University