View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18097_low_16 (Length: 289)

Name: NF18097_low_16
Description: NF18097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18097_low_16
NF18097_low_16
[»] chr2 (2 HSPs)
chr2 (1-112)||(38419454-38419565)
chr2 (109-215)||(38420161-38420267)


Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 38419454 - 38419565
Alignment:
1 gaaattaattaggtttttgagacaaagtacgccattgtctctcaaatactcagatacggtgaagtatgcctgatgcaaggcgatcaagtgccttgtctca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38419454 gaaattaattaggtttttgagacaaagtacgccattgtctctcaaatactcagatacggtgaagtatgcctgatgcaaggcgatcaagtgccttgtctca 38419553  T
101 aatactcagata 112  Q
    ||||||||||||    
38419554 aatactcagata 38419565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 109 - 215
Target Start/End: Original strand, 38420161 - 38420267
Alignment:
109 gatatggtttgtctgccaaggaggatgatgaaacaatagtagattagcaaattatattttcatataggagaccgaaacaccaaaaagttacatgtcatat 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
38420161 gatatggtttgtctgccaaggaggatgatgaaacaatagtagattagcaaattatattttcatataggagaccaaaacaccaaaaagttacatgtcatat 38420260  T
209 gttattc 215  Q
    |||||||    
38420261 gttattc 38420267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University