View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18097_low_16 (Length: 289)
Name: NF18097_low_16
Description: NF18097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18097_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 38419454 - 38419565
Alignment:
| Q |
1 |
gaaattaattaggtttttgagacaaagtacgccattgtctctcaaatactcagatacggtgaagtatgcctgatgcaaggcgatcaagtgccttgtctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38419454 |
gaaattaattaggtttttgagacaaagtacgccattgtctctcaaatactcagatacggtgaagtatgcctgatgcaaggcgatcaagtgccttgtctca |
38419553 |
T |
 |
| Q |
101 |
aatactcagata |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38419554 |
aatactcagata |
38419565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 109 - 215
Target Start/End: Original strand, 38420161 - 38420267
Alignment:
| Q |
109 |
gatatggtttgtctgccaaggaggatgatgaaacaatagtagattagcaaattatattttcatataggagaccgaaacaccaaaaagttacatgtcatat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38420161 |
gatatggtttgtctgccaaggaggatgatgaaacaatagtagattagcaaattatattttcatataggagaccaaaacaccaaaaagttacatgtcatat |
38420260 |
T |
 |
| Q |
209 |
gttattc |
215 |
Q |
| |
|
||||||| |
|
|
| T |
38420261 |
gttattc |
38420267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University