View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18099_low_10 (Length: 219)
Name: NF18099_low_10
Description: NF18099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18099_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 26325575 - 26325763
Alignment:
| Q |
18 |
atcaccagaatgtggttgaacatggacatggtagtaacattggaaatgtcccatttaattccaatgcaatgccacaaaatgaccatggcattcaacatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26325575 |
atcaccagaatgtggttgaacatggacatggtagtaacattggaaatgtcccatttaattccaatgcaatgccacaaaatgaccatggcattcaacatgg |
26325674 |
T |
|
| Q |
118 |
aaggagtggtaattatgatccattcaattacaatttagtatcacaagaaaatgatcatggcattcttcaacatggagggggtagaaatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26325675 |
aaggagtggtaattatgatccattcaattacaatttagtatcacaagaaaatgatcatggcattcttcaacatggagggggtagaaatt |
26325763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 108 - 171
Target Start/End: Original strand, 26325740 - 26325803
Alignment:
| Q |
108 |
ttcaacatggaaggagtggtaattatgatccattcaattacaatttagtatcacaagaaaatga |
171 |
Q |
| |
|
||||||||||| || || | ||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
26325740 |
ttcaacatggagggggtagaaattatgatccattcaattacaatttaatatcaccagaaaatga |
26325803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 122 - 175
Target Start/End: Complemental strand, 48320306 - 48320253
Alignment:
| Q |
122 |
agtggtaattatgatccattcaattacaatttagtatcacaagaaaatgatcat |
175 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
48320306 |
agtggtaataatgatccatttgcttacaatttagaatcaccagaaaatgatcat |
48320253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University