View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18099_low_6 (Length: 346)
Name: NF18099_low_6
Description: NF18099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18099_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 15 - 328
Target Start/End: Original strand, 23467350 - 23467663
Alignment:
| Q |
15 |
cacagatgaggaagaaagcctttgacagctttaacaagatacgagcaatgattatgatgataatcagtgttatcactgatatagcagcgagtatattcac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
23467350 |
cacagatgaggaagaaagcctttgacagctttaacaaaatacgtgcaatgattatgatgataatcagtgttaccactgatatagcagcgattatattcac |
23467449 |
T |
|
| Q |
115 |
tctcttatcttccatatcagaacttcacattttatgttgtatgataaagatggaatggaagataaaagataaattattagatttctcacctttgtaatat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
23467450 |
tctcttatcttccatatcagaacttcacattttatgttttatgataaagatggaatggaagataaaagttgaattattagatttctcacctttgtaatat |
23467549 |
T |
|
| Q |
215 |
tcttgtgagaacatgaagagttgaatagttcatcaactttgcttgcaattacagataaaggatgttcaactttcatttgaatatatttaactaaaacaaa |
314 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23467550 |
tcttgtgagaacatgaagagttgattagttcagcagttttgcttgcaattacagataaaagatgttcaactttcatttgaatatatttaactaaaacaaa |
23467649 |
T |
|
| Q |
315 |
gcgtggaccatttc |
328 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23467650 |
gcgtggaccatttc |
23467663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University