View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18099_low_8 (Length: 233)
Name: NF18099_low_8
Description: NF18099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18099_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 17265953 - 17265812
Alignment:
| Q |
22 |
aaggcagtaccctgcattgcagtggaaaatgagaaagagagaatagaaaagctcatggtagggactgttactaagatactggaaatctttattatgggga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17265953 |
aaggcagtaccctgcattgcagtggaaaatgagaaagagagaatagaaaagctcatggtagggactgttactaagatactggaaatct---atatgggga |
17265857 |
T |
 |
| Q |
122 |
tcatccataacaagaacaacgaaatagttatcaacacacgtgatc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17265856 |
tcatccataacaagaacaacgaaatagttatcaacacacgtgatc |
17265812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University