View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809R-Insertion-16 (Length: 395)
Name: NF1809R-Insertion-16
Description: NF1809R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809R-Insertion-16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 146 - 314
Target Start/End: Original strand, 10371014 - 10371182
Alignment:
| Q |
146 |
attatttctttctaatgatgatatttttcaaatgtgtttgggtggtttccactcaaaagttcctagaatgctaggcttgtattcaagaaatggagttcct |
245 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
10371014 |
attatttctttctaatgatgatattcttcaaatgtgtttgggtggtttccactcaaaagttcctagaatgctaggctcgtgttcaaataatggagttcct |
10371113 |
T |
|
| Q |
246 |
taattactaatcctaaactcattcgtatgagaaagattagtactcaatatcaacatctatggttgtttg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10371114 |
taattactaatcctaaactcattcgtatgagaaagattggtactcaatatcaacatctatggttgtttg |
10371182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University