View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1809R-Insertion-17 (Length: 335)
Name: NF1809R-Insertion-17
Description: NF1809R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1809R-Insertion-17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 7 - 335
Target Start/End: Complemental strand, 40179801 - 40179482
Alignment:
| Q |
7 |
caatagtacaatcaaattgattgaaatataattacgaaactgaaaatgaacattaagatgaaatgaaaaaatgttacctgcagaaccaggcagtgtgatt |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40179801 |
caatagtacaatcaaattgactgaaatataattacgaaactgaaaatgaacattaagatgaaatgaaaaaatgttacctgcagaaccaggcagtgtgatt |
40179702 |
T |
|
| Q |
107 |
ggtggaggaggtgtcactttgagcccccctacaatgttggatttcttagcatttggtgctttgaatgcactgttaaccatatttccattcatgtttgtct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
40179701 |
ggtggaggaggtgtcactttgagcccccctacaatgttggatttcttagcatttggtgctttgaatggactgttaaccata---------atgtttgtct |
40179611 |
T |
|
| Q |
207 |
cattgttttcctcctcagtgctccattccattttgtcactatcaacaataacctcatcctcatcctcttcattttcatcctctttattacattgctctaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40179610 |
cattgttttcctcctcagtgctccattccattttgtcactatcaacaatagcctcatcctcatcctcttcattttcatcctctttattacattgctctaa |
40179511 |
T |
|
| Q |
307 |
cgccggcacaccttcaactggatcaccat |
335 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
40179510 |
cgccggcacaccttcaacttgatcaccat |
40179482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University